Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
mmu_circRNA_40806 | |||
Gene | n/a | Organism | Mouse |
Genome Locus | n/a | Build | n/a |
Disease | Ischemic brain after stroke | ICD-10 | Stroke, not specified as haemorrhage or infarction (I64) |
DBLink | Link to database | PMID | 29156814 |
Experimental Method | |||
Sample Type | Brain Tissues | Comparison | Ischemic brain tissues before and after stroke, which was induced by 45 min of transient Middle Cerebral Artery Occlusion (MCAO). |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward CGGTATTGGAATGAGTGGAA ReverseTATGAGGGAGGACTCTTAGCA | Statistics | Fold Change : Downregulated,0.417897758 pvalue : p=0.000152 |
Citation | |||
Liu, C, Zhang, C, Yang, J, Geng, X, Du, H, Ji, X, Zhao, H (2017). Screening circular RNA expression patterns following focal cerebral ischemia in mice. Oncotarget, 8, 49:86535-86547. |